Library structure
Stay organised - create a folder for the project to keep things tidy.
PROJECT=./scarecrow/examples/Scale
mkdir -p ${PROJECT}Download Scale Bio data from NCBI SRA accession:SRR28867557.
mkdir -p ${PROJECT}/fastq
ACC=SRR28867557
prefetch --output-directory ${PROJECT}/fastq ${ACC}
fasterq-dump ${PROJECT}/fastq/${ACC} -e 2 --split-files --include-technical --force --outdir ${PROJECT}/fastq
gzip ${PROJECT}/fastq/${ACC}_1.fastq # Index 2
gzip ${PROJECT}/fastq/${ACC}_2.fastq # Index 1
gzip ${PROJECT}/fastq/${ACC}_3.fastq # This read contains the barcodes and UMI
gzip ${PROJECT}/fastq/${ACC}_4.fastq # This read contains the target sequenceThis step requires barcode whitelists associated with the assay being used. These are available in the references folder of the ScaleRna github repo: https://github.com/ScaleBio/ScaleRna/tree/master/references. We only require the barcode sequence for scarecrow, so this needs cutting from the ligation barcode (3lvlRNA_lig.txt), reverse transcription barcode (3lvlRNA_rt.txt), and pcr barcode (3lvlRNA_pcr.txt) files (i.e. cut -f1 3lvlRNA_lig.txt > ${PROJECT}/barcode_whitelists/3lvlRNA_lig.txt). Once the whitelists are generated, barcodes can then be defined as colon-delimited strings (<barcode index>:<whitelist name>:<whitelist file>) in a bash array for later use. For convenience, we have provided in the scarecrow repo the below barcode files.
BARCODES=(BC1:lig:${PROJECT}/barcode_whitelists/3lvlRNA_lig.txt
BC2:rt:${PROJECT}/barcode_whitelists/3lvlRNA_rt.txt
BC3:pcr:${PROJECT}/barcode_whitelists/3lvlRNA_pcr.txt)We can now run scarecrow seed to process each barcode whitelist. The below example is for a SLURM HPC, but will work on a standard PC by omitting the sbatch line. It randomly samples 10k reads from the first 100k in the FASTQ files and records the start positions of barcodes, their orientation, nucleotide frequencies per position, and conserved sequence runs.
mkdir -p ${PROJECT}/barcode_profiles
FASTQS=(${PROJECT}/fastq/*.fastq.gz)
for BARCODE in ${BARCODES[@]}
do
scarecrow seed \
--num_reads 10000 \
--upper_read_count 100000 \
--fastqs ${FASTQS[@]} \
--barcodes ${BARCODE} \
--out ${PROJECT}/barcode_profiles/barcodes.${BARCODE%%:*}.csv
doneThe above example uses the default set-based barcode matching method. The alternative is to use the trie-index method which is better suited to much larger barcode whitelists. The indexing method can be either kmer or seed based (see pickle). For comparison purposes, we run both methods here.
FASTQS=(${PROJECT}/fastq/*.fastq.gz)
METHODS=('kmer' 'seed')
for METHOD in ${METHODS[@]}
do
mkdir -p ${PROJECT}/${METHOD}/barcode_profiles
for BARCODE in ${BARCODES[@]}
do
scarecrow seed \
--num_reads 10000 \
--upper_read_count 100000 \
--fastqs ${FASTQS[@]} \
--barcodes ${BARCODE} \
--pickle ${PROJECT}/${METHOD}/barcodes.${BARCODE%%:*}.pkl.gz \
--index ${METHOD} \
--out ${PROJECT}/${METHOD}/barcode_profiles/barcodes.${BARCODE%%:*}.csv
done
doneThe barcode profiles generated by scarecrow seed are gathered with scarecrow harvest to identify the likely barcode index positions. The --barcode_count parameter specifies the number of barcodes to return for each barcode index, and should typically be set to 1 unless debugging. The --min_distance parameter sets the minimum distance required between the end and start positions of two barcodes.
BARCODE_FILES=(${PROJECT}/barcode_profiles/barcodes.*.csv)
scarecrow harvest \
${BARCODE_FILES[@]} \
--barcode_count 1 \
--min_distance 10 \
--out ${PROJECT}/barcode_profiles/barcode_positions.csvBoth the set- and trie-based methods are processed in the same manner with harvest. However, to illustrate that the same barcode profiles are generated, we can repeat the above on the trie-based method outputs from seed.
METHODS=('kmer' 'seed')
for METHOD in ${METHODS[@]}
do
BARCODE_FILES=(${PROJECT}/${METHOD}/barcode_profiles/barcodes.*.csv)
scarecrow harvest \
${BARCODE_FILES[@]} \
--barcode_count 1 \
--min_distance 10 \
--conserved ${PROJECT}/${METHOD}/barcode_profiles/barcodes.${BARCODES[0]%%:*}_conserved.tsv \
--out ${PROJECT}/${METHOD}/barcode_profiles/barcode_positions.csv
doneThe plots generated by harvest indicates that barcode matches were found on read 1 (SRR28867557_1.fastq.gz) in forward orientation at positions 1, and read 3 (SRR28867557_3.fastq.gz) in forward orentation at positions 1 and 24. This is consistent with the expectation from the (0-based) library structure described in the ScaleRna JSON https://github.com/ScaleBio/ScaleRna/blob/master/references/libV1.1.i5_rc.json. SRR28867557_2.fastq.gz returned a conserved sequence, indicated by the red shading. No matches were identified on SRR28867557_1.fastq.gz for barcodes in reverse orientation, or on SRR28867557_2.fastq.gz for barcodes in forward orientation. Matches were identified on SRR28867557_3.fastq.gz for barcodes in reverse orientation, and for SRR28867557_4.fastq.gz for barcodes in either orientation, resulting in plots being generated, although the counts were insignificant and returned no peaks.
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
The regions for the three barcodes (one per whitelist) identifed by harvest are highlighted in blue. These are recorded in the barcode_positions.csv file for use with reap.
barcode_whitelist,file_index,file,orientation,start,end,read_count,read_fraction
BC3:pcr,0,SRR28867557_1.fastq.gz,forward,1,10,9853,1.0
BC1:lig,2,SRR28867557_3.fastq.gz,forward,1,9,9407,1.0
BC2:rt,2,SRR28867557_3.fastq.gz,forward,24,33,4976,0.58Now that the barcode positions have been characterised we can extract the target sequence with scarecrow reap. This will also record barcode metadata (sequence, qualities, corrected sequence, positions, mismatches) and UMI data (sequence, quailties). The output can be either SAM format (default) or FASTQ. The range to --extract requires a 1-based FASTQ index followed by the positional range (i.e. 4:1-76), and --umi follows the same format to indicate where the UMI sequence is (i.e. 3:17-24). The --jitter parameter indicates the number of flanking bases to extend the barcode start position by when looking for a match. As barcode 2 was found to start at positions 24 and 25 we should set --jitter 1. The --mismatch parameter indicates the maximum number of mismatches permitted when matching the barcode against a whitelist - also known as the edit distance.
We're running this on a SLURM HPC and it takes around an 2h30m using 16 cores.
THREADS=16
BQ=10
JITTER=2
MISMATCH=2
FASTQS=(${PROJECT}/fastq/*.fastq.gz)
OUT=$(basename ${FASTQS[0]%.fastq*})
mkdir -p ${PROJECT}/extracted/J${JITTER}M${MISMATCH}
sbatch --ntasks 1 --cpus-per-task ${THREADS} \
--mem 8G --time=12:00:00 -o reap.%j.out -e reap.%j.err \
scarecrow reap \
--threads ${THREADS} \
--batch_size 20000 \
--fastqs ${FASTQS[@]} \
--barcode_positions ${PROJECT}/barcode_profiles/barcode_positions.csv \
--barcodes ${BARCODES[@]} \
--extract 4:1-76 --umi 3:17-24 \
--jitter ${JITTER} \
--mismatch ${MISMATCH} \
--base_quality ${BQ} \
--out ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT} \
--out_fastq(Optional) Check that the read count in the resulting FASTQ file is equal to that of one of the input FASTQ files. Here is an example of counting reads using seqtk and awk on non-interleaved and interleaved FASTQ files.
# A non-interleaved input FASTQ file
seqtk seq ${FASTQS[0]} | awk '/^@/ {c++} END {print c}'
# Interleaved scarecrow FASTQ file
seqtk seq ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}.fastq | awk '/^@/ {c++} END {print c/2}'In addition to generating an interleaved FASTQ file, scarecrow outputs a JSON file indicating the barcode and UMI positions on read 1, and the parameters required to use the file with the kb count tool of kallisto-bustools. In addition, the tools outputs a _mismatch_stats.csv and a _position_stats.csv file. The mismatch_stats CSV has the following format:
mismatches,count
-2,6675291
-1,37366978
0,293542244
1,12593597
2,4935434
3,357517
4,401159
5,17193Indicating the number of reads recorded for each sum of mismatches across its barcodes. Negative numbers indicate the number of reads for which no barcode was found (i.e. -1 is one barcode unmatched, -2 is two barcodes unmatched, ...). Although we used --mismatch 2, a mismatch count of three is possible if for example each of the three barcodes has one mismatch, or one barcode has two mismatches and another has 1 mismatch.
The position_stats CSV follows a similar format, indicating the count of barcodes starting at each position within --jitter 1 :
position,count
*,1551
-1,1372346
1,700463986
2,2446549
23,4500938
24,186144490
25,122020819
N,50717560This illustrates that millions of reads have barcodes not starting at the expected positions. Note, the Scale Bio RNA library structure is as follows:
# Read 1 (read_3.fastq.gz) : LIG (BC2) [1-9] | SPLINT (LINKER) [10-16] | UMI [17-24] | RT (BC1) [25-34]
# Index 2 (read_1.fastq.gz) : PCR (BC3) [1-10]The ScaleRna workflow uses the linker as an anchor for determining the offset start positions of the UMI and BC1, acknowledging that the linker could start at (0-based) position 8 or 9.
We observe a significant number of BC1 barcodes starting at position 24. We also note that 99% of BC2 barcodes end with a T nucleotide when BC1 starts at position 24. Manual inspection of read 3 sequences show that the linker sequence (TCAGAGC) often shares that T nt with BC1. For example, below is the first 10 reads with the linker sequence marked:
NACTGGCA`TCAGAGC`GTATCATTAGAGAAGGTTT
NTACCTAAG`TCAGAGC`ATTTGGCCGAAGATCGAG
NCAGATAC`TCAGAGC`ACGGGCTATAGATCTACTT
NCAGCGGT`TCAGAGC`GGAGGTTGCAGTGAGCCGA
NCTGGACC`TCAGAGC`TGGTGGAATTATTCATTCT
NTCTTCAGA`TCAGAGC`ATTCAAGCACTATGCAAT
NACGAGCG`TCAGAGC`CGCGGAGGGACCTTGATAT
NTCGGAGT`TCAGAGC`GATGACCCCGGATTAGAAT
NCAAGATCT`TCAGAGC`CTAACTAAACTTAACCTT
NCAATGCTA`TCAGAGC`AGGCTCTTGCCATTCTCCIn the above example, all of the BC2 sequences (first 9 bases) "truncated" by 1 nt has a barcode match that ends with T. This sharing of the T nucleotide between BC2 and linker impacts the positions of downstream UMI and BC1 elements. Below is an example:
@SRR28867557.450070 A01209:299:HH7MLDRX3:1:2102:24659:1204 length=34
TGGACCTCTCAGAGCGCTTACCACTCAATAGGTT
||||||||| BC2 (TGGACCTCT)
|||||||. Linker (TCAGAGC)
|||||||| UMI (CTTACCAC expected position)
||||||||||. BC1 (CTCAATAGGT expected based on start 24)
||||||||||.. BC1 (ACTCAATAGG exact barcode match)
The ScaleRna workflow appears to overcome this by using linker-anchor offset approach. However, in that approach BC1 would start at position 24, and the resulting BC1 sequence has no exact match in the 3lvlRNA_rt.txt whitelist. By contrast, there is an exact barcode match starting at position 23 which is detected by scarecrow when using --jitter 1 on the expectation that BC1 starts at position 24. However, because scarecrow does not currently adjust the UMI position to account for jitter, this results in a 2 nt overlap between the UMI and BC1. Consequently, downstream tools (e.g. umi-tools) can be used for UMI correction.
If using the trie-based method, reap would be run using the pickle indices instead of the whitelists, as follows:
THREADS=16
BQ=10
JITTER=1
MISMATCH=2
FASTQS=(${PROJECT}/fastq/*.fastq.gz)
METHODS=('kmer' 'seed')
for METHOD in ${METHODS[@]}
do
BARCODES=(BC1:lig:${PROJECT}/${METHOD}/barcodes.BC1.pkl.gz
BC2:rt:${PROJECT}/${METHOD}/barcodes.BC2.pkl.gz
BC3:pcr:${PROJECT}/${METHOD}/barcodes.BC3.pkl.gz)
OUT=$(basename ${FASTQS[0]%.fastq*})
mkdir -p ${PROJECT}/extracted/${METHOD}/J${JITTER}M${MISMATCH}
sbatch -p uoa-compute --ntasks 1 --cpus-per-task ${THREADS} --mem 96G --time=24:00:00 -o reap.%j.out -e reap.%j.err \
scarecrow reap \
--threads ${THREADS} \
--batch_size 20000 \
--fastqs ${FASTQS[@]} \
--barcode_positions ${PROJECT}/${METHOD}/barcode_profiles/barcode_positions.csv \
--barcodes ${BARCODES[@]} \
--extract 4:1-76 --umi 3:17-24 \
--jitter ${JITTER} \
--mismatch ${MISMATCH} \
--out ${PROJECT}/extracted/${METHOD}/J${JITTER}M${MISMATCH}/${OUT} \
--out_fastq
doneThe below table summarises the number of mismatches identified at each jitter from 0 to 1, allowing upto 2 mismatches.
| Mis | Jitter 0 | Jitter 1 |
|---|---|---|
| -2 | 10191330 | 6675291 |
| -1 | 156364488 | 37366978 |
| 0 | 175732492 | 293542244 |
| 1 | 6870125 | 12593597 |
| 2 | 6255723 | 4935434 |
| 3 | 231657 | 357517 |
| 4 | 234255 | 401159 |
| 5 | 9343 | 17193 |
The number of valid barcodes is the sum of those with >=0 mismatches. This can be easily calculated from the mismatch stats file.
OUT=$(basename ${FASTQS[0]%.gz})
awk -F, 'NR>1 && $1 >= 0 {sum += $2} END {print sum}' $PROJECT/extracted/J${JITTER}M${MISMATCH}/${OUT}_mismatch_stats.csvThe below table summarises the number of barcode position matches identified at each jitter from 0 to 1, allowing upto 2 mismatches.
| Pos | Jitter 0 | Jitter 1 |
|---|---|---|
| * | 1551 | |
| -1 | 1372346 | |
| 1 | 700879847 | 700463986 |
| 2 | 2446549 | |
| 23 | 4500938 | |
| 24 | 190041244 | 186144490 |
| 25 | 122020819 | |
| N | 176747148 | 50717560 |
The Scale barcode whitelists have 96 (3lvlRNA_rt and 3lvlRNA_pcr) and 384 (3lvlRNA_lig) 9-mer barcodes. Given the larger size of one of these whitelists compared to the Parse data, the seed index method is more efficient than the default set-based method, as evident from the SLURM job logs summarised below.
| Method | CPU Utilized | CPU Efficiency | Wall-clock time | Memory Utilized |
|---|---|---|---|---|
| Set (J0M2) | 16:08:54 | 30.57% | 03:18:06 | 3.53 GB |
| Kmer (J0M2) | 1-01:15:10 | 63.42% | 02:29:19 | 2.84 GB |
| Seed (J0M2) | 10:06:40 | 25.25% | 02:30:09 | 2.83 GB |
| Set (J1M2) | 19:51:06 | 38.79% | 03:11:56 | 3.52 GB |
| Kmer (J1M2) | 2-14:04:31 | 93.71% | 04:08:25 | 5.07 GB |
| Seed (J1M2) | 14:57:59 | 39.03% | 02:23:47 | 2.97 GB |
Reads with one or more invalid barcode are uninformative in downstream analyses as they could not be confidently demultiplexed. We can filter these reads out either by using the --sift flag when running reap, or by using the sift tool afterwards. Here we demonstrate sift after running reap. As we are providing a scarecrow FASTQ input we also need to provide the accompanying JSON file. If a scarecrow SAM input is provided then no JSON file is required.
OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}.fastq
sbatch -p uoa-compute --ntasks 1 --mem 2G --time=12:00:00 -o sift.%j.out -e sift.%j.err \
scarecrow sift --in ${FASTQ} --json ${FASTQ%.fastq}.jsonTo improve downstream alignment results it is highly recommended to trim the reads to remove and adapter sequences or template switching oligo (TSO) sequences. Not all reads possess these sequences, and those that do will not necessarily share the same start position. There is a contaminants list in the Parse splitpipe repo which can be formatted for use with cutadapt. Note, we use the -G rather than the -g flag for cutadapt because the sequence to be trimmed is on the read 2 output by scarecrow, rather than read 1.
CONTAMINANTS=~/sharedscratch/software/ParseBiosciences-Pipeline.1.4.1/splitpipe/scripts/config/fastqc-contaminant_list.txt
awk '
# Skip blank lines and comment lines
NF && $0 !~ /^#/ {
seq = $NF
header = ""
for (i = 1; i < NF; i++) {
header = header $i " "
}
gsub(/[ \t]+$/, "", header)
# Use a separate array to track seen sequences
if (header != "" && !(seq in seen)) {
seen[seq] = 1
print ">" header
print seq
}
}
' ${CONTAMINANTS} > ${PROJECT}/contaminants.fasta
OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=$(basename ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_sift.fastq)
sbatch --ntasks 1 --cpus-per-task 4 --mem 16G --time=12:00:00 -o cutadapt.%j.out -e cutadapt.%j.err \
cutadapt --cores 4 --trim-n --minimum-length 30 --interleaved \
-G file:${PROJECT}/contaminants.fasta \
-o ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ%_sift.fastq}_trimmed.fastq \
${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ}OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.fastq
sbatch -p uoa-compute --ntasks 1 --mem 4G --time=12:00:00 -o stats.%j.out -e stats.%j.err \
scarecrow stats --in ${FASTQ}Next we can generate a count matrix using kallisto. There is a script in the scarecrow repo, kallisto.sh, that parses the JSON file generated by reap to retrieve the -x string required for running the FASTQ file with kb count. This requires the JSON sed-like processor, jq, to be installed. This enables the -x flag to be extracted as follows:
XSTR=$(${jq} -r '."kallisto-bustools"[0]."kb count" | capture("-x (?<x>[^ ]+)").x' ${JSON})The kallisto.sh script requires the kallisto --index and --genes for the reference assembly in question, in addition to the FASTQ and JSON files generated by scarecrow.
#conda deactivate
#mamba activate kallisto
mkdir -p ${PROJECT}/kallisto/J${JITTER}M${MISMATCH}
OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=$(basename ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.fastq)
sbatch -p uoa-compute --ntasks 1 --cpus-per-task 8 --mem 4G --time=12:00:00 --dependency=afterok:2711459 \
~/sharedscratch/scarecrow/scripts/kallisto.sh \
--index /uoa/scratch/users/s14dw4/software/kallisto/hg38/transcriptome.idx \
--genes /uoa/scratch/users/s14dw4/software/kallisto/hg38/transcripts_to_genes.txt \
--fastq ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ} \
--json ${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${FASTQ%_trimmed.fastq}.json \
--out ${PROJECT}/kallisto/J${JITTER}M${MISMATCH}/${FASTQ%.fastq}Before aligning with STAR, if we wish to incoprorate the barcode and UMI read tags we should first recast the FASTQ file to SAM format.
OUT=$(basename ${FASTQS[0]%.fastq.gz})
FASTQ=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.fastq
sbatch -p uoa-compute --ntasks 1 --mem 2G --time=24:00:00 -o recast.%j.out -e recast.%j.err \
scarecrow recast --in ${FASTQ}Given the compute requirements for running STAR this is best performed on a HPC. Alignment first requires the reference genome be indexed with STAR. Below is an example using 8 threads and used 48G on a SLURM HPC. The GRCh38 reference genome and annotation (GTF) were indexed using an overhang of 74 - the length of the read containing the sequence to align.
STAR --runThreadN ${SLURM_NTASKS} \
--runMode genomeGenerate \
--genomeDir ${GENOME_DIR} \
--genomeFastaFiles ${GRCh38.FA} \
--sjdbGTFfile ${GRCh38.GTF} \
--sjdbOverhang 74Next, we align with STAR from scarecow SAM format.
mkdir -p ${OUT}
ID=$(basename ${SAM%.sam})
/uoa/scratch/users/s14dw4/software/STAR --runThreadN ${SLURM_CPUS_PER_TASK} \
--genomeDir ${GENOME} \
--readFilesIn ${SAM} \
--readFilesType SAM SE \
--outFileNamePrefix ${OUT}/${ID}. \
--outSAMtype BAM Unsorted \
--outFilterMultimapNmax 3The script is run on the HPC as follows:
mkdir -p ${PROJECT}/star/J${JITTER}M${MISMATCH}
OUT=$(basename ${FASTQS[0]%.fastq.gz})
SAM=${PROJECT}/extracted/J${JITTER}M${MISMATCH}/${OUT}_trimmed.sam
ID=$(basename ${SAM%.sam})
GENOME=/uoa/scratch/users/s14dw4/spipe/genomes/hg38
sbatch -p uoa-compute --ntasks 1 --cpus-per-task 32 --mem 24G --time=02:00:00 -o star.%j.out -e star.%j.err \
./scarecrow/scripts/star_align_sam_scale.sh \
--genome ${GENOME} \
--sam ${SAM} \
--out ${PROJECT}/star/J${JITTER}M${MISMATCH}Next step is to run umi-tools. The reference GTF file we use for this has a slighltly different config naming convention to the reference we used for alignment with STAR. To address this issue we generate an alias file for use with featureCounts from the subread package, see the umi-tools single-cell tutorial for more details. We have included a script in the scarecrow repo, umi_tools.sh which runs featureCounts followed by umi-tools count to generate a counts matrix.
GTF=/uoa/scratch/shared/Morgan_Lab/common_resources/cellranger/reference/refdata-gex-GRCh38-2020-A/genes/genes.gtf
OUT=$(basename ${FASTQS[0]%.fastq.gz})
BAM=${PROJECT}/star/J${JITTER}M${MISMATCH}/*.bam
# Need to create contig look-up as GTF does not have hg38_ prefix to contigs
mkdir -p ${PROJECT}/umi_tools/J${JITTER}M${MISMATCH}
samtools view -H ${BAM} | cut -f2 | grep "^SN" | sed 's/SN://g' | \
awk '{split($0, TIG, "_"); print TIG[2]","$0;}' > ${PROJECT}/umi_tools/alias.file
# Run UMI-tools
sbatch --partition uoa-compute ./scarecrow/scripts/umi_tools.sh \
--bam ${BAM} \
--gtf ${GTF} \
--out ${PROJECT}/umi_tools/J${JITTER}M${MISMATCH} \
--alias ${PROJECT}/umi_tools/alias.fileNext, the umi_tools output can be converted to a matrix format for downstream processing in R in a similar manner to the kallisto output.
COUNTS=${PROJECT}/umi_tools/J${JITTER}M${MISMATCH}/*.featureCounts.counts.tsv.gz
sbatch --partition uoa-compute ./scarecrow/scripts/counts2mtx.sh --in ${COUNTS}





